First baseUvAG1.)2.)3.)UUUUUUCUUAUUG1.)2.)3.)PheLeuCUUTCUCCUACUGGUUTGUCGUAGUGLeuAUUAUC lleAUAAUG startMet orValSecond baseCAUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGSerProThrAlaUAUUGUTyrCysUACUGCUAA Stop UGA Stop AUAG Stop UGG TrpCAUCACCAACAGAAUAACAAAAAGGAUGACGAAGAGHisGinAsnLysAspGGluCGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGArgSerArgGlyUCAGсUCAGАUCAGсАUCACсGProvide the nine base sequence of the mRNA in triplet form.1.)2.)3.).List the three tRNA anticodons in triplet form.Third baseUse the codon map to determine the amino acids coded by the mRNA strand (please use onlythe abbreviations):

Central dogma is molecular process in which particular DNA sequence undergo transcription and…

First base U C A G 1.) 2.) 3.) U UUUT UUC UUA UUG CUUT CUC CUA CUG 1.) 2.) 3.) Phe U GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or start Val Second base C A UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UGU Tyr UAC UGC UAA Stop UGA Stop A CAU CAC CAA CAG UAG Stop UGG Trp AAU AAC AAA 7 AAG GAU GAC GAA GAG His Gin Asn Lys G Asp Glu CGU CGC CGA CGG AGU AGC AGA 7 AGG Cys GGU GGC GGA GGG Arg Ser Arg Gly DCAG U с ос C G UU. : G DCAG А Provide the nine base sequence of the mRNA in triplet form. 1.) 2.) 3.). List the three tRNA anticodons in triplet form. Third base Use the codon map to determine the amino acids coded by the mRNA strand (please use only the abbreviations):

First base U C A G 1.) 2.) 3.) U UUUT UUC UUA UUG CUUT CUC CUA CUG 1.) 2.) 3.) Phe U GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or start Val Second base C A UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UGU Tyr UAC UGC UAA Stop UGA Stop A CAU CAC CAA CAG UAG Stop UGG Trp AAU AAC AAA 7 AAG GAU GAC GAA GAG His Gin Asn Lys G Asp Glu CGU CGC CGA CGG AGU AGC AGA 7 AGG Cys GGU GGC GGA GGG Arg Ser Arg Gly DCAG U с ос C G UU. : G DCAG А Provide the nine base sequence of the mRNA in triplet form. 1.) 2.) 3.). List the three tRNA anticodons in triplet form. Third base Use the codon map to determine the amino acids coded by the mRNA strand (please use only the abbreviations):

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter10: Skin Deep

Section: Chapter Questions

Problem 1CTE

See similar textbooks