Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG

Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

Tn Midterm test Fall 2020 (page 2 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D6971498page=1 SQU E-leaning System (Academic) Question 21 The direction of mRNA molecule synthesis is .: Not yet answered Select one: Marked out of O a. From DNA strand that starts with 5' 1.00 O b. In the direction of 3' to 5 P Flag question O c. From DNA strand that starts with 3' O d. From RNA strand that starts with 3' O e. From RNA strand that starts with 5' Question 22 Which of the following organelles do plants and animals have in common? Not yet answered Select one: Marked out of O a. mitochondria, ribosome, nucleus, cell membrane, cytoplasm 1.00 O b. mitochondria, vacuole, nucleus, cell membrane, cell wall F Flag question O c. mitochondria, vacuole, nucleus, cell membrane, centrioles O d. mitochondria, vacuole, nucleus, cell membrane, cell wall, chloroplasts O e. mitochondria, vacuole, nucleus, cytoplasm, cell wall, lysosome
DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتب
B. Answer the following questions briefly. 1. How do we know that complementary base pairs in DNA really exist? 2. Compare and contrast replication, transcription and translation based on template used, direction of synthesis, protein/enzyme requirements during initiation, elongation and termination and products. CRITERIA of Replication Transcription Translation comparison 1. Template used 2. direction of synthesis 3. protein enzyme requirements a. Initiation b. Elongation c. Termination 4. Products 3. How do we know that expression of the information encoded in DNA involves an RNA intermediate?
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C
Procedure: 1. Using the DNA provided transcribe DNA into mRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA A AGACCGTATAC mRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2 How does this protein help the body maintain homeostasis2
erm test Fall 2020 (page 1 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt31335328&cmid%3D697149 -aming System (Academic) Fon 3 "DNA is passed from one generation to another during cells division after DNA replication". et red which of the following statements regarding DNA replication is NOT correct: d out of Select one: O a. Each DNA strand of the double helix will be copied g question O b. The newly synthesized strand will have the complementary sequence of the parental template strand O c. The daughter cell will have doub the amount of DNA that the parental cell had n 4 Which of the following ketoses contain the same number of carbons as glucose? ed Select one: out of O a. Sucrose O b. Fructose question O c. Ribose O d. Galactose O e. Aldose 5) helps maintaining the skin's cells and prevents the growth of some
Instructions -Answer thr Questions properly. MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA "MUTATED DNA" (SEE IMAGE) a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? - Substitution - Missense (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication. Please supply the specific pieces of information requested by the boxes below. 1. What enzyme relaxes the supercoils? 2. What enzyme unwinds the DNA? 7. What does this arrow represent? 3. What enzyme synthesizes the RNA primer 8. Why should this single-stranded portion be stabilized? 4. What is this short segment of DNA called? 9. What enzyme synthesizes this long DNA segment? 5. What enzyme removes the RNA primer and replaces it with DNA? 10. Is this the leading or the lagging side? 6. What enzyme joins the short segments of DNA together? 3
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.